TABLE 2

Primers for screening PEPT2 transformants

SpeciesDirectionPCR PrimerProduct
bp
HumanForwardTATGGATGTAAAGGCACTGA323
ReverseTTTTTATCTCTACAGCTGCC
MouseForwardGTTTTGGCGAAGACTGCTAT302
ReverseCATGGGCAGTGGGATATAAA
RatForwardAGTCTTCTACCTCGCCATCAAT307
ReverseTTTTTCTGCTGCCCAGTCTA
  • bp, base pairs.