TABLE 3

Primers used for real-time RT-PCR quantification of transcription

Target GeneDirectionPrimer Sequence
GAPDHForwardAAGGTGAAGGTCGGAGTCAA
ReverseAATGAAGGGGTCATTGATGG
CYP3A4ForwardTTTTGTCCTACCATAAGGGCTTT
ReverseCACAGGCTGTTGACCATCAT
CYP24A1ForwardGGTGACATCTACGGCGTACAC
ReverseCTTGAGACCCCCTTTCCAGAG
  • GAPDH represents the housekeeping gene used for normalization of the transcription of CYP3A4 and CYP24A1. GAPDH, glucose 6-phosphate dehydrogenase.