TABLE 2

Gene primers used for RT-PCR quantification of hepatic gene expression in prolonged cultured human hepatocytes

Customer PrimersTaqman Primers
TFF: ATGGTCCCAGTGTTGCVTTGTALBHS00910225_m1
R: CATCCAGTGTCACAGCATCCHPRT1Hs02800695_m1
TTRF: ACTTGGCATCTCCCCATTCASGR1HS01005019_m1
R: TAGGAGTAGGGGCTCAGCAGABCB1HS00184500_m1
GAPDHF: AAGGTGAAGGTCGGAGTCAAABCB11HS00184824_m1
R: AATGAAGGGGTCATTGATGGABCC2HS00166123_m1
CYP1A2F: CTTCGTAAACCAGTGGCAGGABCC3HS00978473_m1
R: AGGGCTTGTTAATGGCAGTGABCC4HS00988734_m1
CYP2B6F: CCCTTTTGGGAAACCTTCTGABCG2HS01053790_m1
R: GTCCCAGGTGTACCGTGAAGSLC10A1HS00161820_m1
CYP2C8F: CTCGGGACTTTATGGATTGCSLC22A1HS00427552_m1
R: CAGTGCCAACCAAGTTTTCASLC22A7HS00198527_m1
CYP2C9F: TGCTTCCTGATGAAAATGGASLCO1B1HS00272374_m1
R: TCTCTGTCCCAGCTCCAAACSLCO1B3HS00251986_m1
CYP2C19F: TTGCTTCCTGATCAAAATGGSLCO2B1HS00200670_m1
R: GTCTCTGTCCCAGCTCCAAG
CYP2D6F: TGGACTTCCAGAACACACCA
R: CCCATTGAGCACGACCAC
CYP3A4F: TTTTGTCCTACCATAAGGGCTTT
R: CACAGGCTGTTGACCATCAT
CYP3A7F: GGGAAATGCTTTGTCCTTCC
R: AGCCAGCATAGGCTGTTGAC