TABLE 1

Oligonucleotide sequences used as primers for quantitation of gene mRNA levels through quantitative PCR assays

GenePrimer sequence
PparaF: CAGTGGGGAGAGAGGACAGA
R: AGTTCGGGAACAAGACGTTG
Cyp2d22F: ACCGGTAAAGGTAGCTGGAGT
R: CATAGGGCCTGGAGGGTAGT
Hnf4aF: CGGAGCCCCTGCAAAGT
R: ACTATCCAGTCTCACAGCCCATTC
Cyp2e1F: TGGTCCTGCATGGCTACAAG
R: CGGGCCTCATTACCCTGTTT
Cyp2c29F: TGTTACAAACCCCCGTGACT
R: GGATGTGGATAAAGACCTGAGAC
Cyp2c44F: CCTAAAGGCTCTGGTGGAGC
R: GAAACAAATGCCCACGTGCT
Cyp3a14F: GGCCCAGTGGGGATAATGAG
R: GGTGCCTTATTGGGCAGAGT
Cyp3a25F: TAGAAACCTGGGTGCTGCTG
R: GGATGTGGATAAAGACCTGAGAC
PxrF: AAGAAGCAGACTCTGCCTTGGA
R: GTGGTAGCCATTGGCCTTGT
CarF: CCTCTTCTCCCCTGGTTTCTG
R: TCATTGCCACTCCCAAGCTC
RxraF: CAGTACGCAAAGACCTGACCTACA
R: GTTCCGCTGTCTCTTGTCGAT
RxrbF: AAGTGTCTGGAGCACCTGTTCTT
R: CTCCATGAGGAAGGTGTCAATG
Cyp1a1F: GAAGTGGAAGGGCATAGGCAG
R: GGCCAAAGCATATGGCACAG
Cyp1a2F: ACTTCGAACCAGTCAGCCAG
R: GTGCTTGAACAGGGCACTTG
Cyp1b1F: CCAGCTTTTTGCCTGTCACC
R: TGCACTGATGAGCGAGGATG
AhrF: TTCAGAACTGACTCCACCGC
R: CCGGGTGTGATATCGGGAAG
AhrrF: AGTGTACATACGCCGGTAGG
R: CAAGACTGGTGCCACAATGC
Hsp90F: CAGACCATGGTGAGCCCATT
R: TCAACCACACCGCGGATAAA
eNosF: GCAGAAGAGTCCAGCGAACA
R: GGCAGCCAAACACCAAAGTC
iNosF: GTGTTCCACCAGGAGATGTTG
R: CTCCTGCCCACTGAGTTCGTC
  • F, forward; R, reverse.