TABLE 1

Primers and probes used for real-time quantitative RT-PCR in this study

NamePrimer SequenceAccession No.
ALAS1GGATCGGGATGGAGTCATGCNM_001285030.1
GGACCGTACCGTGTCAATCA
ALAS2TGCCCGGGTGTGAGATTTACXM_015443623.1
AACTTGGCTGCTCCACTGTT
BAATAACTATGAAGACCTGCCCGCXM_005581173.2
GGGCCAAAGACCTTCGGATG
BCRPCGGGTCTGTTGGTCAATCTCAXM_015450641.1
GCTGCAAAGCCGTAAATCCA
CYP3A8CATGATCAAAACAGTGCTAGTGANM_001284534.1, XM_015447118.1
AGCAATGACCGTATTCTCTTCCA
CYP7A1GGAGAAGGCAAACGGGTGAAXM_005563370.2
ATTGGCACCAAATTGCAGCG
FXRGGAATGTTGGCTGAATGCTTGTXM_005571991.2
TTGTCGAGGTCACTTGTCGC
MDR1 (P-gp)AGACATGACGGATACCTTTGCNM_001287322.1
AGGCATACCTGGTCATATCTTCC
MRP2GACTGATAAGAGGCCTCCGCNM_001287716.1
GCCCACCACACCAATCTTCT
MRP3ACTGTGTGCCCTCATCTTGGXM_005583690.2
GGCCATCTTTGTGAACCACC
MRP4GTGGGAGCAGGGAAGTCATCXM_005586096.2
CAGTTCCCGAGAACACCCAG
OATP1B1TGCACTTGGAGGCACCTCATNM_001284540.1
TGCTCGTATAACCATTGAGTGGA
OATP1B3TGCTGGGAGTCATAACCATTCCNM_001283191.1
AAATTTGGCAATTCCAACTAAAGAC
OATP1B1/1B3AAATTGGAAATTTGCTTGTGATTGTNM_001284540.1, NM_001283191.1
GTAATATCCCATGAAGAAATGTGGT
OSTαCATCGCCTCGTTTTATGCCGXM_005545271.2
CTGTGTGGACCATCATCGGG
OSTβCGGCTGTGGTGGTCATGATAXM_005559810.2
GCATCTTTTGTTTTCTGCTTGCC
PPIAGTCTCCTTCGAGCTGTTTGCAXM_005550655
TTCTGTGAAAGCAGGAACCCTT
SHPCTCTTCAACCCTGATGTGCCXM_005544304.2
CAGGGCTCCAGGACTTCACA
NTCPCACGGTTCTCTCTGCCATCANM_001283323.1
TCGGCACCGTCCATTGAG
UGT1A1TGGAACCCCACCATCGAATCNM_001283438.1
CGGGTCATTGGGTGACCAAG