- Split View
-
Views
-
Cite
Cite
Richard A. Graham, Bryan Goodwin, Raymond V. Merrihew, Wojciech L. Krol, Edward L. LeCluyse, Cloning, Tissue Expression, and Regulation of Beagle Dog CYP4A Genes, Toxicological Sciences, Volume 92, Issue 2, August 2006, Pages 356–367, https://doi.org/10.1093/toxsci/kfl009
- Share Icon Share
Abstract
In addition to its function as a fatty acid hydroxylase, the peroxisome proliferator-activated receptor α (PPARα) target gene, CYP4A, has been shown to be important in the conversion of arachidonic acid to the potent vasoconstrictor 20-hydroxyeicosatetraenoic acid, suggesting a role for this enzyme in mediating vascular tone. In the present study, the cDNA sequence of beagle dog CYP4A37, CYP4A38, and CYP4A39 from the liver was determined. Open reading frame analysis predicted that CYP4A37, CYP4A38, and CYP4A39 each comprised 510 amino acids with ∼ 90% sequence identity to one another, and ∼ 71 and 78% sequence identity to rat CYP4A1 and human CYP4A11, respectively. PCR analysis revealed that the three dog CYP4A isoforms are expressed in kidney > liver ≫ lung ≫ intestine > skeletal muscle > heart. Treatment of primary dog hepatocytes with the PPARα agonists GW7647X and clofibric acid resulted in an increase in CYP4A37, CYP4A38, and CYP4A39 mRNA expression (up to fourfold), whereas HMG-CoA synthase mRNA expression was increased to a greater extent (up to 10-fold). These results suggest that dog CYP4A37, CYP4A38, and CYP4A39 are expressed in a tissue-dependent manner and that beagle dog CYP4A is not highly inducible by PPARα agonists, similar to the human CYP4A11 gene.
Fatty acids are vital nutrients for the growth and development of all organisms. In addition to providing substrates for membrane synthesis and energy metabolism, they are also components of multiple signaling cascades and directly regulate gene transcription through their activities on transcription factors such as peroxisome proliferator-activated receptor α (PPARα). CYP4A enzymes are fatty acid hydroxylases that are expressed in most mammalian tissues and highly expressed in kidney, liver, and lung. These enzymes are selective for the ω-hydroxylation of saturated and unsaturated fatty acids (Hardwick et al., 1987; Helvig et al., 1998; Hoch and Ortiz De Montellano, 2001; Kimura et al., 1989b; Nguyen et al., 1999; Stromstedt et al., 1990; Wang et al., 1996). Although fatty acids represent the primary substrates for CYP4A enzymes, it has also been shown that these enzymes can metabolize non–fatty acid substrates such as the potent vasodilator 20-hydroxyeicosatetraenoic acid (20-HETE) (Harder et al., 1995; Okita and Okita, 2001). It was recently shown that inhibition of CYP ω-hydroxylase results in a reduction in infarct size in a dog model for cardiac injury (Nithipatikom et al., 2004, 2006), suggesting that CYP4A has a detrimental role in enhancing myocardial injury in canine heart.
Across species, CYP4A is primarily expressed in liver and kidney, with lower expression levels in other tissues. CYP4A1, CYP4A2, and CYP4A3 mRNAs are constitutively expressed in rat liver (Kimura et al., 1989b). In the male rat kidney, CYP4A1 and CYP4A3 mRNAs are expressed at low levels, whereas CYP4A2 mRNA levels were found to be similar to those of maximally induced CYP4A2 mRNA levels in the liver (Kimura et al., 1989b). CYP4A protein was not detected by immunoblot analysis in rat small intestine (Patel et al., 1998) and was relatively low in rat brain, heart, and lung (Zhang et al., 2002). Expression of CY4A11 mRNA in human tissues has been reported using real-time PCR. CYP4A11 was highly expressed in liver and kidney (liver to kidney ratio 2.4:1), whereas expression was relatively low (2–3 orders of magnitude less than liver) in small intestine, adrenal gland, lung, brain, prostate, testis, uterus, and placenta (Nishimura et al., 2003).
For many years it has been recognized that the transcriptional activity of the genes encoding various CYP4A subfamily members is dramatically increased by numerous structurally diverse xenochemicals, collectively referred to as peroxisome proliferators (PPs) (Okita and Okita, 2001). In mouse (Bell et al., 1993), rat (Kimura et al., 1989b), and hamster (Choudhury et al., 2000) liver and kidney, CYP4A enzymes are induced by various PPARα activators including the fibrate class of lipid-lowering drugs. It has been shown that in rat liver, CYP4A proteins represent 1–4% of total CYP, but increase to 16–30% following clofibrate administration (Sharma et al., 1989). On the other hand, the CYP4A induction response is not observed in guinea pig (Bell et al., 1993) or in cultured human hepatocytes (Raucy et al., 2004) following treatment with PPs. For example, while treatment of cultured rat hepatocytes with clofibrate elicited a large induction (14-fold), exposure of primary human hepatocytes to the same drug resulted in a modest induction of CYP4A11 mRNA (approximately twofold) (Madan et al., 1999; Raucy et al., 2004).
Beagle dog is a model species that is widely used in the pharmaceutical industry during the drug development process. Previously we reported that clofibric acid administration to beagle dogs failed to induce dog liver CYP4A protein or microsomal lauric acid 12-hydroxylation, suggesting that CYP4A is not inducible in this species (Graham et al., 2002). Results of our previous studies suggested that dog CYP4A might be regulated in a manner similar to CYP4A from other nonresponsive species such as human CYP4A11.
CYP4A enzymes have gained attention recently because they metabolize arachidonic acid to 20-HETE. In fact, it has been suggested that targeting of CYPs in the heart and coronary circulation could be of therapeutic utility in coronary artery disease based in part on results from a dog model of cardiac injury (Doggrell, 2005). Given the importance of various canine models in drug discovery efforts, it is important to characterize dog CYP4A isoform expression and regulation, yet little is known about the sequence homology and regulation of the individual dog CYP4A genes. In the present study, we report on cDNA cloning, tissue expression, and regulation of dog CYP4A37, CYP4A38, and CYP4A39.
MATERIALS AND METHODS
Chemicals and Reagents
Dulbecco's modified Eagle's medium (DMEM) and fetal bovine serum were purchased from Cambrex Bioscience (Walkersville, MD). Insulin, GlutaMAX (dipeptide L-alanyl-L-glutamine 200mM supplied in 0.85% NaCl), penicillin/streptomycin (pen/strep), NuPage gels, polyvinylidene difluroide membranes, and related electrophoresis reagents were purchased from Invitrogen Corporation (Carlsbad, CA). ECL Western Blotting Analysis System was purchased from Amersham Biosciences (Buckinghamshire, UK). Biocoat plates, Matrigel, and ITS+ (insulin, transferrin, selenium) were purchased from BD Biosciences (Bedford, MA). Collagenase (type I), dexamethasone, DMSO, EGTA, D-(+)-glucose, L-glutamine, Percoll, thymidine, and trypan blue were purchased from Sigma-Aldrich (St Louis, MO). Bicinchoninic acid protein assay reagents were purchased as a kit from Pierce Chemical Co (Rockford, IL). Oligonucleotides for cloning and sequencing were purchased from Sigma-Genosys (St Louis, MO). TaqMan primers and probes and PCR master mix were purchased from Applied Biosystems (Foster City, CA). Proteinase K and DNase were purchased from Qiagen Inc. (Valencia, CA). Clofibric acid was obtained from ICN Biomedicals (Aurora, OH) and GW7647X was prepared in-house as previously described (Brown et al., 2001).
PPARα Transfection Assay
Plasmids.
PCR primers containing KpnI and BamHI restriction sites were used to amplify PPARα ligand-binding domain (LBD) fragments from full-length human and dog clones. The LBD fragments were ligated into the multiple-cloning site of pFA-CMV (Stratagene, La Jolla, CA). The resulting constructs (pFA-CMV-GAL4-hPPARαLBD and pFA-CMV-GAL4-dogPPARαLBD) each carried a fusion of the LBD with the yeast-derived GAL4 DNA-binding domain under the control of the CMV immediate early promoter. The reporter construct UAS-tk-Luc carries a single 17 bp (5′-CGGAGTACTGTCCTCCG-3′) upstream activating sequence (UAS), the thymidine kinase (tk) minimal promoter, and the firefly luciferase gene.
Cell-based luciferase assay.
African green monkey kidney cell line CV-1 (ATCC CCL-70) was maintained in DMEM containing 10% fetal bovine serum, 2mM glutamine, and 1% pen/strep. In preparation for luciferase assays, CV-1 cells were grown in charcoal-stripped (CS) cell medium containing DMEM/F-12 medium supplemented with 5 or 3% dextran-treated/CS fetal bovine serum, 2mM glutamine, with or without 1% pen/strep, as described below. CS fetal bovine serum was purchased from Hyclone (Logan, UT); all other cell culture reagents were from Gibco/Invitrogen (Grand Island, NY).
The luciferase protocol is a multiday procedure. On day 1, confluent cells in maintenance medium were subcultured 1:10 into T-175 cm2 flasks containing 50 ml of 3% CS medium with pen/strep. These flasks were allowed to incubate at 5% CO2 and 37°C for 72 h.
Cells were harvested by trypsinization and then transfected using FuGENE (Roche, Basel, Switzerland) according to the manufacturer's specifications. Briefly, each transfection contained 0.27 (PPARα) or 0.55 (PPARγ and PPARδ) μg pFA-CMV-GAL4-PPAR-LBD plasmid (human or dog), 10.9 μg UAS-tk-Luc, and 24 μg pBluescript (carrier DNA). Plasmid DNA was mixed with FuGENE in OptiMEM-1 (Invitrogen) medium and incubated for 30 min at room temperature. During this incubation, cells were harvested into 3% CS medium without pen/strep and dispensed at 14 million cells per T-175 cm2 flask. Transfection mixes were added to the flasks and incubated overnight at 5% CO2 and 37°C.
Transfected cells were added to 384-well plates containing pharmacological agents. Stock solutions of test compounds were reconstituted in DMSO at a concentration of 1mM. For 11-point dose-response experiments, the compounds were threefold serially diluted in DMSO and then transferred to 384-well assay plates (NUNC, catalog #164564) at 0.5-μl/well using a Beckman (Fullerton, CA) FX. DMSO and agonist control compound GI249820X (1mM) were each transferred at 0.5-μl/well to columns 23 and 24, respectively, of the 384-well plates. Transfected cells were harvested in 5% CS medium with pen/strep and dispensed at 10,000 cells per well (50 μl) onto the prepared 384-well compound plates using a Titertek Multidrop. Following overnight incubation at 5% CO2 and 37°C, Steady-Glo reagent (Promega, Madison, WI) was added to the assay plates using a Multidrop. Plates were incubated for 10 min to ensure complete cell lysis and read in a ViewLux (PerkinElmer, Wellesley, MA).
cDNA Cloning
Approximately 100 mg of frozen male beagle dog liver was ground to a fine powder using a mortar and pestle under liquid nitrogen. Total RNA was isolated using the Qiagen RNeasy Mini Kit (Qiagen). RT-PCR was carried out in two steps using the Advantage RT-for PCR Kit followed by the BD Advantage 2 PCR Kit (BD Biosciences, Palo Alto, CA). To determine whether a portion of the putative dog CYP4A cDNA could be amplified by PCR, oligonucleotides were designed based on the published human CYP4A11 cDNA sequence (accession number L04751) cloned from human kidney. Primer CYP4A-F1 (5′-CACCATGAGTGTCTCTGTGCTGAGCC-3′) was based on sequence approximately 100 bp from the 5′-end of the human CYP4A cDNA sequence while primer CYP4A-R1 (5′-CTCCTGAGACGCAGGTGGATTCCAT-3′) was approximately 1600 bp from the 5′-end of the human CYP4A sequence or about the midpoint of the complete transcript. PCR was conducted using the CYP4A-F1 and CYP4A-F2 primer pair described above, and after agarose gel electrophoresis, a band of the expected size (∼ 1.5 kb) was obtained. The generated cDNA was gel purified using the QIAquick Gel Extraction Kit (Qiagen). Gel-purified cDNA was subcloned using the TOPO TA Cloning Kit for sequencing (Invitrogen). cDNA was isolated from subsequent clones using the QIAprep 96 Turbo Miniprep Kit (Qiagen) and submitted for sequencing.
The 5′-end of the dog CYP4A sequence was determined using the GeneRacer Kit from Invitrogen, whereas determination of the 3′-end of the dog CYP4A sequence was accomplished using the SMART RACE cDNA Amplification Kit (BD Biosciences, Palo Alto, CA). Gene specific primers were designed based on the internal sequencing information obtained from the 1.5-kb region described above. Sequencing of the 3′-RACE products revealed approximately 800 bp of untranslated sequence between the stop codon and the poly-A tail. Sequencing of 5′-RACE products resulted in approximately 40 bp of untranslated sequence upstream of the open reading frame. Sequence information from the 5′-RACE and 3′-RACE experiments as well as the open reading frame regions was assembled using Sequencher alignment software (version 4.0.5).
Hepatocyte Isolation and Culture
Male beagle dogs (GlaxoSmithKline, Research Triangle Park, NC) were euthanized, and the livers were perfused by a modification of the previously described collagenase digestion method (LeCluyse et al., 1996; Madan et al., 1999; Seglen, 1976). Dog hepatocytes were cultured as described previously (Graham, 2006). Hepatocytes (n = 3 dog livers) were cultured in six-well Biocoat plates and treated daily for 48 h with vehicle (0.1% DMSO), GW7647X (0.01, 0.1, 1, 5, and 10μM), or clofibric acid (1, 10, 100, 500, and 1000μM). At the end of the treatment period, each treatment group was harvested for mRNA analysis. Samples from each treatment group were tested in duplicate in subsequent TaqMan assays.
RNA Isolation and cDNA Synthesis
For absolute quantification experiments, total RNA was isolated from dog tissue by column extraction using a Qiagen RNeasy Mini Kit (Qiagen). RNA isolation from skeletal muscle and heart was accomplished using a proteinase K digestion step as recommended by the manufacturer. Following RNA extraction, samples were DNase treated and quantified using a Ribogreen RNA Quantitation Kit (Molecular Probes, Eugene, OR), and cDNA was synthesized using a cDNA Archive Kit (Applied Biosystems).
For relative quantification experiments, total RNA was isolated from cultured dog hepatocytes using the Automated SV 96 Total RNA Isolation System (Promega) and quantified using a Ribogreen RNA Quantitation Kit (Molecular Probes), and cDNA was synthesized using a cDNA Archive Kit (Applied Biosystems).
Microsome Preparation and Western Blot
Microsomes were isolated from dog hepatocyte cultures followed by Western blot analysis of CYP4A expression as described previously (Graham et al., 2002). The protein concentration in the microsomal samples was determined with a BCA Protein Assay Kit, according to Technical Bulletin 23225X from Pierce Chemical Co (Smith et al., 1985; Wiechelman et al., 1988). For Western blots, 10 μg of microsomal protein was loaded per well. The primary antibody was a human CYP4A antipeptide antibody (Affinity Bioreagents, Golden, CO) at a dilution of 1:1000. The secondary antibody was a peroxidase-labeled anti-rabbit antibody included in the ECL Western Blotting Analysis System (Amersham Biosciences) which was diluted 1:1000 in blocking buffer.
TaqMan Assays
Custom TaqMan gene expression assays were purchased from Applied Biosystems. Briefly, a probe target site was identified at an exon-exon junction in the gene of interest and submitted to Applied Biosystems Global Assays by Design Department using File Builder software program. Assays were supplied at 20× and consisted of primer (forward and reverse) and minor groove binder (MGM) probe. Primer and probe sequences used in this study are listed in Table 1.
Primer . | Sequence (5′–3′) . | Orientation . | Purpose . | Isozymes . |
---|---|---|---|---|
CYP4A-F1 | 5′-CACCATGAGTGTCTCTGTGCTGAGCC-3′ | Forward | PCR cloning | 37, 38, and 39 |
CYP4A-R1 | 5′-CTCCTGAGACGCAGGTGGATTCCAT-3′ | Reverse | PCR cloning | 37, 38, and 39 |
CYP4A-R2 | 5′-CCAGGGCGCCAAAGCTAAGG-3′ | Reverse | 5′-RACE | 37, 38, and 39 |
d4A-gsp1(f) | 5′-GGACAGAGAAATACCCTTGTGCCA-3′ | Forward | Sequencing/3′-RACE | 37 and 38 |
d4A-gsp2(r) | 5′-ATCAGTGAAGGTGATGGGCTTGCT-3′ | Reverse | Sequencing | 37, 38, and 39 |
d4A-gsp3(f) | 5′-ATGGAGAATGGGAAGGGCTTGTCTGA-3′ | Forward | Sequencing | 37, 38, and 39 |
d4A-gsp4(r) | 5′-TGGTGTCCAAGGTCATCAAGGAGA-3′ | Reverse | Sequencing/5′-RACE | 37, 38, and 39 |
d4A-gsp5(f) | 5′-AAACCCTACGTGAGACTCATGGCT-3′ | Forward | Sequencing/3′-RACE | 37, 38, and 39 |
d4A-gsp6(f) | 5′-ATGCCCTTCACCACAACCCAAATG-3′ | Forward | Sequencing | 39 |
d4A-gsp7(f) | 5′-TTGCCATGAACGAGTTGAAGGTGG-3′ | Forward | Sequencing | 37, 38, and 39 |
d4A-gsp9(f) | 5′-TGTTCCTTGCTGCCTACTTGTCT-3′ | Forward | Sequencing | 37 and 38 |
d4A-gsp11(f) | 5′-TGCCAACTTACTCCAGTCTCAGTG-3′ | Forward | Sequencing | 39 |
d4A-grp1&2 (r) | 5′-AAGTGGACCAAAGGTGGACTGACA-3′ | Reverse | Sequencing | 37 and 38 |
d4A-grp 3 (r) | 5′-TGGGTACACAGGTAACACACAGGA-3′ | Reverse | Sequencing | 39 |
GROUP1-AF | ACCCAGACTACATGAAGATGATCCT | Forward | TaqMan | 37 |
GROUP1-AR | AGGAGCAAACCATACCCTATCCA | Reverse | TaqMan | 37 |
GROUP1-AM1 | CTGGTGGTTCCTACACATT | Probe | TaqMan | 37 |
GROUP2-AF | GGCACAGGCAAGAGTTCCA | Forward | TaqMan | 38 |
GROUP2-AR | GGCGCAAGGGTATTTCTCTGT | Reverse | TaqMan | 38 |
GROUP2-AM2 | CAGCTCCCGACCCTTT | Probe | TaqMan | 38 |
GROUP3-AF | GGCACAAGCGGGAGTTG | Forward | TaqMan | 39 |
GROUP3-AR | TGGGAAGTCCTCTATCCATTTCAGT | Reverse | TaqMan | 39 |
GROUP3-AM2 | CAGCTCGTCTCCTTTTT | Probe | TaqMan | 39 |
PPIA.4sF | TGCACCGCCAAGACTGA | Forward | TaqMan | Cyclophilin |
PPIA.4sR | GACCTTGCCAAAGACCACATG | Reverse | TaqMan | Cyclophilin |
PPIA.4sM1 | CTTGCCGTCCAACCAC | Probe | TaqMan | Cyclophilin |
HMG-CoA-F | GCCAACTGGGTGGAATCCA | Forward | TaqMan | HMG-CoA synthase |
HMG-CoA-R | GATACACTGCAATGTCTCCACAGA | Reverse | TaqMan | HMG-CoA synthase |
HMG-CoA-M1 | CCTGGGATGGTCGCTATG | Probe | TaqMan | HMG-CoA synthase |
Primer . | Sequence (5′–3′) . | Orientation . | Purpose . | Isozymes . |
---|---|---|---|---|
CYP4A-F1 | 5′-CACCATGAGTGTCTCTGTGCTGAGCC-3′ | Forward | PCR cloning | 37, 38, and 39 |
CYP4A-R1 | 5′-CTCCTGAGACGCAGGTGGATTCCAT-3′ | Reverse | PCR cloning | 37, 38, and 39 |
CYP4A-R2 | 5′-CCAGGGCGCCAAAGCTAAGG-3′ | Reverse | 5′-RACE | 37, 38, and 39 |
d4A-gsp1(f) | 5′-GGACAGAGAAATACCCTTGTGCCA-3′ | Forward | Sequencing/3′-RACE | 37 and 38 |
d4A-gsp2(r) | 5′-ATCAGTGAAGGTGATGGGCTTGCT-3′ | Reverse | Sequencing | 37, 38, and 39 |
d4A-gsp3(f) | 5′-ATGGAGAATGGGAAGGGCTTGTCTGA-3′ | Forward | Sequencing | 37, 38, and 39 |
d4A-gsp4(r) | 5′-TGGTGTCCAAGGTCATCAAGGAGA-3′ | Reverse | Sequencing/5′-RACE | 37, 38, and 39 |
d4A-gsp5(f) | 5′-AAACCCTACGTGAGACTCATGGCT-3′ | Forward | Sequencing/3′-RACE | 37, 38, and 39 |
d4A-gsp6(f) | 5′-ATGCCCTTCACCACAACCCAAATG-3′ | Forward | Sequencing | 39 |
d4A-gsp7(f) | 5′-TTGCCATGAACGAGTTGAAGGTGG-3′ | Forward | Sequencing | 37, 38, and 39 |
d4A-gsp9(f) | 5′-TGTTCCTTGCTGCCTACTTGTCT-3′ | Forward | Sequencing | 37 and 38 |
d4A-gsp11(f) | 5′-TGCCAACTTACTCCAGTCTCAGTG-3′ | Forward | Sequencing | 39 |
d4A-grp1&2 (r) | 5′-AAGTGGACCAAAGGTGGACTGACA-3′ | Reverse | Sequencing | 37 and 38 |
d4A-grp 3 (r) | 5′-TGGGTACACAGGTAACACACAGGA-3′ | Reverse | Sequencing | 39 |
GROUP1-AF | ACCCAGACTACATGAAGATGATCCT | Forward | TaqMan | 37 |
GROUP1-AR | AGGAGCAAACCATACCCTATCCA | Reverse | TaqMan | 37 |
GROUP1-AM1 | CTGGTGGTTCCTACACATT | Probe | TaqMan | 37 |
GROUP2-AF | GGCACAGGCAAGAGTTCCA | Forward | TaqMan | 38 |
GROUP2-AR | GGCGCAAGGGTATTTCTCTGT | Reverse | TaqMan | 38 |
GROUP2-AM2 | CAGCTCCCGACCCTTT | Probe | TaqMan | 38 |
GROUP3-AF | GGCACAAGCGGGAGTTG | Forward | TaqMan | 39 |
GROUP3-AR | TGGGAAGTCCTCTATCCATTTCAGT | Reverse | TaqMan | 39 |
GROUP3-AM2 | CAGCTCGTCTCCTTTTT | Probe | TaqMan | 39 |
PPIA.4sF | TGCACCGCCAAGACTGA | Forward | TaqMan | Cyclophilin |
PPIA.4sR | GACCTTGCCAAAGACCACATG | Reverse | TaqMan | Cyclophilin |
PPIA.4sM1 | CTTGCCGTCCAACCAC | Probe | TaqMan | Cyclophilin |
HMG-CoA-F | GCCAACTGGGTGGAATCCA | Forward | TaqMan | HMG-CoA synthase |
HMG-CoA-R | GATACACTGCAATGTCTCCACAGA | Reverse | TaqMan | HMG-CoA synthase |
HMG-CoA-M1 | CCTGGGATGGTCGCTATG | Probe | TaqMan | HMG-CoA synthase |
Primer . | Sequence (5′–3′) . | Orientation . | Purpose . | Isozymes . |
---|---|---|---|---|
CYP4A-F1 | 5′-CACCATGAGTGTCTCTGTGCTGAGCC-3′ | Forward | PCR cloning | 37, 38, and 39 |
CYP4A-R1 | 5′-CTCCTGAGACGCAGGTGGATTCCAT-3′ | Reverse | PCR cloning | 37, 38, and 39 |
CYP4A-R2 | 5′-CCAGGGCGCCAAAGCTAAGG-3′ | Reverse | 5′-RACE | 37, 38, and 39 |
d4A-gsp1(f) | 5′-GGACAGAGAAATACCCTTGTGCCA-3′ | Forward | Sequencing/3′-RACE | 37 and 38 |
d4A-gsp2(r) | 5′-ATCAGTGAAGGTGATGGGCTTGCT-3′ | Reverse | Sequencing | 37, 38, and 39 |
d4A-gsp3(f) | 5′-ATGGAGAATGGGAAGGGCTTGTCTGA-3′ | Forward | Sequencing | 37, 38, and 39 |
d4A-gsp4(r) | 5′-TGGTGTCCAAGGTCATCAAGGAGA-3′ | Reverse | Sequencing/5′-RACE | 37, 38, and 39 |
d4A-gsp5(f) | 5′-AAACCCTACGTGAGACTCATGGCT-3′ | Forward | Sequencing/3′-RACE | 37, 38, and 39 |
d4A-gsp6(f) | 5′-ATGCCCTTCACCACAACCCAAATG-3′ | Forward | Sequencing | 39 |
d4A-gsp7(f) | 5′-TTGCCATGAACGAGTTGAAGGTGG-3′ | Forward | Sequencing | 37, 38, and 39 |
d4A-gsp9(f) | 5′-TGTTCCTTGCTGCCTACTTGTCT-3′ | Forward | Sequencing | 37 and 38 |
d4A-gsp11(f) | 5′-TGCCAACTTACTCCAGTCTCAGTG-3′ | Forward | Sequencing | 39 |
d4A-grp1&2 (r) | 5′-AAGTGGACCAAAGGTGGACTGACA-3′ | Reverse | Sequencing | 37 and 38 |
d4A-grp 3 (r) | 5′-TGGGTACACAGGTAACACACAGGA-3′ | Reverse | Sequencing | 39 |
GROUP1-AF | ACCCAGACTACATGAAGATGATCCT | Forward | TaqMan | 37 |
GROUP1-AR | AGGAGCAAACCATACCCTATCCA | Reverse | TaqMan | 37 |
GROUP1-AM1 | CTGGTGGTTCCTACACATT | Probe | TaqMan | 37 |
GROUP2-AF | GGCACAGGCAAGAGTTCCA | Forward | TaqMan | 38 |
GROUP2-AR | GGCGCAAGGGTATTTCTCTGT | Reverse | TaqMan | 38 |
GROUP2-AM2 | CAGCTCCCGACCCTTT | Probe | TaqMan | 38 |
GROUP3-AF | GGCACAAGCGGGAGTTG | Forward | TaqMan | 39 |
GROUP3-AR | TGGGAAGTCCTCTATCCATTTCAGT | Reverse | TaqMan | 39 |
GROUP3-AM2 | CAGCTCGTCTCCTTTTT | Probe | TaqMan | 39 |
PPIA.4sF | TGCACCGCCAAGACTGA | Forward | TaqMan | Cyclophilin |
PPIA.4sR | GACCTTGCCAAAGACCACATG | Reverse | TaqMan | Cyclophilin |
PPIA.4sM1 | CTTGCCGTCCAACCAC | Probe | TaqMan | Cyclophilin |
HMG-CoA-F | GCCAACTGGGTGGAATCCA | Forward | TaqMan | HMG-CoA synthase |
HMG-CoA-R | GATACACTGCAATGTCTCCACAGA | Reverse | TaqMan | HMG-CoA synthase |
HMG-CoA-M1 | CCTGGGATGGTCGCTATG | Probe | TaqMan | HMG-CoA synthase |
Primer . | Sequence (5′–3′) . | Orientation . | Purpose . | Isozymes . |
---|---|---|---|---|
CYP4A-F1 | 5′-CACCATGAGTGTCTCTGTGCTGAGCC-3′ | Forward | PCR cloning | 37, 38, and 39 |
CYP4A-R1 | 5′-CTCCTGAGACGCAGGTGGATTCCAT-3′ | Reverse | PCR cloning | 37, 38, and 39 |
CYP4A-R2 | 5′-CCAGGGCGCCAAAGCTAAGG-3′ | Reverse | 5′-RACE | 37, 38, and 39 |
d4A-gsp1(f) | 5′-GGACAGAGAAATACCCTTGTGCCA-3′ | Forward | Sequencing/3′-RACE | 37 and 38 |
d4A-gsp2(r) | 5′-ATCAGTGAAGGTGATGGGCTTGCT-3′ | Reverse | Sequencing | 37, 38, and 39 |
d4A-gsp3(f) | 5′-ATGGAGAATGGGAAGGGCTTGTCTGA-3′ | Forward | Sequencing | 37, 38, and 39 |
d4A-gsp4(r) | 5′-TGGTGTCCAAGGTCATCAAGGAGA-3′ | Reverse | Sequencing/5′-RACE | 37, 38, and 39 |
d4A-gsp5(f) | 5′-AAACCCTACGTGAGACTCATGGCT-3′ | Forward | Sequencing/3′-RACE | 37, 38, and 39 |
d4A-gsp6(f) | 5′-ATGCCCTTCACCACAACCCAAATG-3′ | Forward | Sequencing | 39 |
d4A-gsp7(f) | 5′-TTGCCATGAACGAGTTGAAGGTGG-3′ | Forward | Sequencing | 37, 38, and 39 |
d4A-gsp9(f) | 5′-TGTTCCTTGCTGCCTACTTGTCT-3′ | Forward | Sequencing | 37 and 38 |
d4A-gsp11(f) | 5′-TGCCAACTTACTCCAGTCTCAGTG-3′ | Forward | Sequencing | 39 |
d4A-grp1&2 (r) | 5′-AAGTGGACCAAAGGTGGACTGACA-3′ | Reverse | Sequencing | 37 and 38 |
d4A-grp 3 (r) | 5′-TGGGTACACAGGTAACACACAGGA-3′ | Reverse | Sequencing | 39 |
GROUP1-AF | ACCCAGACTACATGAAGATGATCCT | Forward | TaqMan | 37 |
GROUP1-AR | AGGAGCAAACCATACCCTATCCA | Reverse | TaqMan | 37 |
GROUP1-AM1 | CTGGTGGTTCCTACACATT | Probe | TaqMan | 37 |
GROUP2-AF | GGCACAGGCAAGAGTTCCA | Forward | TaqMan | 38 |
GROUP2-AR | GGCGCAAGGGTATTTCTCTGT | Reverse | TaqMan | 38 |
GROUP2-AM2 | CAGCTCCCGACCCTTT | Probe | TaqMan | 38 |
GROUP3-AF | GGCACAAGCGGGAGTTG | Forward | TaqMan | 39 |
GROUP3-AR | TGGGAAGTCCTCTATCCATTTCAGT | Reverse | TaqMan | 39 |
GROUP3-AM2 | CAGCTCGTCTCCTTTTT | Probe | TaqMan | 39 |
PPIA.4sF | TGCACCGCCAAGACTGA | Forward | TaqMan | Cyclophilin |
PPIA.4sR | GACCTTGCCAAAGACCACATG | Reverse | TaqMan | Cyclophilin |
PPIA.4sM1 | CTTGCCGTCCAACCAC | Probe | TaqMan | Cyclophilin |
HMG-CoA-F | GCCAACTGGGTGGAATCCA | Forward | TaqMan | HMG-CoA synthase |
HMG-CoA-R | GATACACTGCAATGTCTCCACAGA | Reverse | TaqMan | HMG-CoA synthase |
HMG-CoA-M1 | CCTGGGATGGTCGCTATG | Probe | TaqMan | HMG-CoA synthase |
Absolute quantification experiments were conducted to quantify the number of copies of mRNA for selected cytochrome target genes using an ABI 7500 Sequence Detection System (Applied Biosystems). Plasmid DNA concentration was determined using a Quanti-iT PicoGreen dsDNA Assay Kit (Molecular Probes). Five-point standard curves were prepared from plasmid DNA for CYP4A37, CYP4A38, and CYP4A39 (30, 300, 3000, 30,000, and 300,000 copies). The standard curve Ct values ranged from 19 to 35. For test samples, each reaction consisted of 100 ng cDNA, 2.5 μl 20× assay mix, and 25 μl master mix in a total volume of 50 μl. Standards and samples were evaluated in triplicate. Thermocycling parameters were 50°C (2 min), 95°C (10 min), followed by 40 cycles of 95°C (15 s) and 60°C (1 min).
Relative quantification experiments were conducted to determine relative mRNA expression (treated vs. control) of target genes using an ABI 7500 Sequence Detection System (Applied Biosystems). For test samples, each reaction consisted of 50 ng cDNA, 2.5 μl 20× assay mix, and 25 μl master mix in a total volume of 50 μl. Target gene expression was normalized to the housekeeping gene cyclophilin. Samples were evaluated in triplicate. Thermocycling parameters were 50°C (2 min) and 95°C (10 min) followed by 40 cycles of 95°C (15 s) and 60°C (1 min).
Statistical Analysis
To evaluate the statistical significance of differences between means, equal variance and normality tests were first conducted to determine whether the data were parametrically distributed. For a parametrically distributed data set, a one-way repeated measures analysis of variance was carried out to determine whether there were significant differences between the group means. Statistically significant differences from the controls were identified by a Holm-Sidak post hoc test (p = 0.05 or 5% level of significance).
RESULTS
Cloning of Dog CYP4A37, CYP4A38, and CYP4A39
Two primers (CYP4A-R1 and CYP4A-R2) were designed from the human CYP4A11 cDNA sequence (accession number L04751) and used to amplify CYP4A from dog liver by RT-PCR. 5′- and 3′-RACE were utilized to determine the full-length cDNA sequence of dog CYP4A37, CYP4A38, and CYP4A39 (Figs. 1A–C). The sequence of each isozyme was verified from multiple independent clones and has been submitted to GenBank with accession numbers DQ138950 (CYP4A37), DQ138951 (CYP4A38), and DQ138952 (CYP4A39). The CYP4A37, CYP4A38, and CYP4A39 cDNA sequences are approximately 2400 bp long and contain a 43-, 53-, and 40-nucleotide 5′-UTR, respectively, a 1515-bp open reading frame; and a 769-, 763-, and 876-bp 3′-UTR downstream from the TAA terminal codon. Each cDNA encodes a protein of 510 amino acids containing the CYP signature motif (FxxGxxxCxG) (444–453) which includes the invariant enzyme active-site cysteine (Nelson et al., 1996). The calculated molecular weight of dog CYP4A37, CYP4A38, and CYP4A39 protein is ∼ 59 kDa.
Alignment of rat CYP4A1, CYP4A3 and CYP4A8; dog CYP4A37, CYP4A38, and CYP4A39; and human CYP4A11 and CYPA37 amino acid sequences suggests a high degree of homology and conservation among isoforms (Fig. 2). The deduced amino acid sequence of CYP4A37, CYP4A38, and CYP4A39 share ≥ 90% identity to one another and are approximately 71 and 78% identical to rat CYP4A1 (Kimura et al., 1989a) and human CYP4A11 (Kawashima et al., 2000), respectively (Table 2).
. | CYP4A1 . | CYP4A37 . | CYP4A38 . | CYP4A39 . | CYP4A11 . |
---|---|---|---|---|---|
CYP4A1 | |||||
CYP4A37 | 71.7 | ||||
CYP4A38 | 72.7 | 93.5 | |||
CYP4A39 | 71.1 | 90.4 | 90.6 | ||
CYP4A11 | 77.2 | 78.2 | 78.8 | 78.6 |
. | CYP4A1 . | CYP4A37 . | CYP4A38 . | CYP4A39 . | CYP4A11 . |
---|---|---|---|---|---|
CYP4A1 | |||||
CYP4A37 | 71.7 | ||||
CYP4A38 | 72.7 | 93.5 | |||
CYP4A39 | 71.1 | 90.4 | 90.6 | ||
CYP4A11 | 77.2 | 78.2 | 78.8 | 78.6 |
. | CYP4A1 . | CYP4A37 . | CYP4A38 . | CYP4A39 . | CYP4A11 . |
---|---|---|---|---|---|
CYP4A1 | |||||
CYP4A37 | 71.7 | ||||
CYP4A38 | 72.7 | 93.5 | |||
CYP4A39 | 71.1 | 90.4 | 90.6 | ||
CYP4A11 | 77.2 | 78.2 | 78.8 | 78.6 |
. | CYP4A1 . | CYP4A37 . | CYP4A38 . | CYP4A39 . | CYP4A11 . |
---|---|---|---|---|---|
CYP4A1 | |||||
CYP4A37 | 71.7 | ||||
CYP4A38 | 72.7 | 93.5 | |||
CYP4A39 | 71.1 | 90.4 | 90.6 | ||
CYP4A11 | 77.2 | 78.2 | 78.8 | 78.6 |
Tissue Expression of Dog CYP4A Isoforms
Quantitation of CYP4A mRNA from dog tissues (n = 3 dogs) using real-time PCR indicated that CYP4A37, CYP4A38, and CYP4A39 are highly expressed in kidney and liver (Fig. 3A). CYP4A37, CYP4A38, and CYP4A39 mRNA were expressed to a similar extent in the liver, whereas kidney expression of CYP4A37 was higher than CYP4A38 and CYP4A39 (7.8-fold and 2.2-fold, respectively). Expression of dog CYP4A37, CYP4A38, and CYP4A39 mRNAs was also notable in lung but was ∼ 3% of liver expression. In contrast, CYP4A expression was relatively low in the intestine, skeletal muscle, and heart (Fig. 3B).
Potency of PPARα Agonists
While clofibric acid is widely used as a tool to study PPARα regulation, its potency is relatively weak against PPARα compared to newer molecules. For example, GW7647X was shown to be a potent human PPARα agonist with ∼ 200-fold selectivity over PPARγ and PPARδ (Brown et al., 2001). To evaluate the effect of GW7647X and clofibric acid on dog PPARα activation, a transactivation assay using GAL4-PPARα LBD was performed as described in the “Materials and Methods” section. GW7647X was highly potent and efficacious against dog PPARα (EC50 = 7.6nM, maximum response = 93% of agonist control), whereas clofibric acid showed little discernable activity against this receptor (EC50 > 10μM, maximum response = 14% of agonist control) (data not shown). Similar results were obtained for activation of human PPARα using GW7647X (EC50 = 6.5nM, maximum response = 90% of agonist control) and clofibric acid (EC50 > 10μM, maximum response = 13% of agonist control). Furthermore, we have shown that GW7647X demonstrates approximately 100- and 4000-fold selectivity over PPARδ and PPARγ isoforms, respectively (data not shown).
Induction of Dog CYP4A Isoforms
To investigate whether dog CYP4A isoforms were inducible by PPARα agonists, cultures of dog hepatocytes (n = 3) were treated with GW7647X or clofibric acid, followed by real-time PCR analysis of mRNA expression. Treatment of dog hepatocytes with GW7647X (0.01–10μM) or clofibric acid (1–1000μM) resulted in a slight (up to 1.9-fold) but statistically significant induction of CYP4A37 and CYP4A38 at the highest concentrations tested (Figs. 4A and 4B). Notably, CYP4A39 was induced to the greatest extent (up to fourfold) compared with CYP4A37 and CYP4A38, and a concentration-dependent increase was observed between 0.1 and 10μM and 10 and 1000μM for GW7647X and clofibric acid, respectively (Fig. 4C). In contrast to the minor induction of dog CYP4A isoforms, the previously characterized PPARα target gene HMG-CoA synthase was induced by ∼ 9.5- and 6-fold by GW7647X and clofibric acid, respectively (Fig. 4D) (Nagasawa et al., 2004). Western blot analysis indicated that CYP4A protein expression was consistent with mRNA levels following treatment with GW7647X and clofibric acid (Fig. 5).
DISCUSSION
Beagle dogs (and associated models) are widely used in the pharmaceutical industry during drug discovery and development. While much is known about the regulation of CYP enzymes in other model species (e.g., rat, mouse), little information is available on the regulation of dog CYP enzymes. In the present study, the cDNA sequences of beagle dog CYP4A37, CYP4A38, and CYP4A39 from liver were determined and the relative tissue expression was examined. In addition, CYP4A induction was measured in cultured dog hepatocytes following treatment with the PPARα agonists, GW7647X and clofibric acid.
Sequence analysis suggests that the original mammal CYP4 gene cluster was composed of CYP4X, CYP4A, and CYP4B. This set is likely derived from the fish CYP4T gene, with the 4B sequence being most like the 4T sequence. It is likely that two serial gene duplications occurred: 4B giving rise to 4A and 4A giving rise to 4X. In humans and chimps, 4X gave rise to 4Z; however, 4Z does not seem to exist in any other species. Rodents have expanded on the basic CYP4 set by expanding the 4As. Opossum doubled 4B and 4X but still have just one 4A. Dogs have 4X1, 4A36, 4A37, 4A38, 4A39, and 4B1. The CYP4A36 gene has a sequence gap that contains five exons (exons 5–9), so it is not complete (David Nelson, personal communication).
Dog CYP4A37, CYP4A38, and CYP4A39 each contain the signature sequence of 10 residues including the invariant active-site cysteine residue. It has been established that a heme is covalently bound in the CYP4A family via a conserved glutamic acid residue on the I-helix of the protein, and the amino acid context of this glutamic acid (EGHDTT) is highly conserved (Hoch and Ortiz De Montellano, 2001). As expected, this active-site heme-binding motif is completely conserved in beagle dog CYP4A37, CYP4A38, and CYP4A39 (positions 321–326). Although the crystal structure of CYP4A has not been determined, Chang and Loew (1999) constructed a three-dimensional model of the human CYP4A11 and identified the location of active-site residues. Amino acids identified in the active site of CYP4A11 included tyrosine-120, leucine-132, tyrosine-317, phenylalanine-318, glutamate-321, glycine-322, tyrosine-325, and valine-386. Each of these active-site amino acids is completely conserved in beagle dog CYP4A37, CYP4A38, and CYP4A39. Interestingly, while pig CYP4A21 shares 74% homology with human CYP4A11, this enzyme lacks lauric acid hydroxylase activity, presumably due to amino acid differences identified in the active-site region (Lundell et al., 2001). Conservation of key amino acids that have been shown to be involved in substrate region specificity suggests that dog CYP4A37, CYP4A38, and CYP4A39 enzymes might function as fatty acid ω-hydroxylases; however, further studies are needed to demonstrate the catalytic properties of dog CYP4A enzymes.
In the present work we show that male beagle dog CYP4A37, CYP4A38, and CYP4A39 mRNA expression was greatest in the liver and kidney, although there was also notable expression in the lung. Expression levels in intestine, skeletal muscle, and heart were low. These results are in agreement with CYP4A tissue expression patterns in other species (e.g., male rats and humans) (Kimura et al., 1989b; Nishimura et al., 2003; Patel et al., 1998; Zhang et al., 2002). Previous studies have described CYP4A isoform expression profiles, and they suggest that male rat CYP4A1, CYP4A2, and CYP4A3 are all constitutively expressed at similar levels in the liver. Contrary to rat liver CYP4A expression, profiles in the male rat kidney suggest that CYP4A1 and CYP4A3 are expressed at low levels compared to CYP4A2 (Kimura et al., 1989b). In fact, these studies showed that CYP4A2 expression levels in the kidney of untreated male rats were similar to induced CYP4A2 mRNA levels in the liver. Interestingly, like rat, dog has three CYP4A isoforms that likely encode an enzymatically active protein. Furthermore, beagle dog CYP4A37 mRNA expression was approximately threefold higher in kidney than in liver, while CYP4A38 and CYP4A39 kidney expressions were comparable to liver expression. The relevance of this differential expression pattern in kidney is unclear; however, these results suggest that dog CYP4A37 mRNA expression in the kidney might be regulated in a manner similar to rat CYP4A2.
Follow-up studies of patients who have undergone fibrate drug therapy (Frick et al., 1987) and experiments with cultured human hepatocytes (Blaauboer et al., 1990; Richert et al., 2003) have suggested that humans do not display the same CYP4A inductive effect as that observed in rats and mice. Similarly, the guinea pig (Bell et al., 1993) and dog (Graham et al., 2002) appear to be refractory to the CYP4A inductive effects of PPs. While it is generally understood that CYP4A induction in the rodent is mediated by PPARα, the mechanism for the observed species differences in CYP4A induction is unclear (Lee et al., 1995). Several theories for this apparent lack of inducibility have been advanced. First, it has been suggested that species not responsive to PPs lack a functional peroxisome proliferator response element (PPRE) (Lambe et al., 1999; Woodyatt et al., 1999). To date, there has not been a functional PPRE identified in the promoter region of the human CYP4A11 gene, whereas rat CYP4A1 and rabbit CYP4A6 promoter regions contain functional elements (Aldridge et al., 1995; Muerhoff et al., 1992). Second, levels of PPARα are an order of magnitude lower in nonresponsive species (e.g., guinea pigs and humans) in comparison to rodents (Tugwood et al., 1998). Recently, it was shown that dog PPARα is expressed at levels similar to human PPARα in cultured hepatocytes (Nagasawa et al., 2004). A third possibility stems from the observation that there is a two–amino acid difference in the PPARα LBD between rats and humans that is critical for the responsiveness to receptor activation (Miyachi and Uchiki, 2003; Uchiki and Miyachi, 2004). Finally, another hypothesis to explain the CYP4A species difference is that nonresponsive species may lack an activator or have an active repressor of PPARα function. While each of these theories have been investigated to some extent, there has not been a definitive study published to date that clearly demonstrates the mechanism for the observed species differences in CYP4A induction. Further studies of CYP4A regulation in dog and other nonresponsive species might help to elucidate the mechanism for species-dependent induction of the CYP4A family.
The results of the current studies suggest that dog CYP4A37, CYP4A38, and CYP4A39 are expressed in a tissue-dependent manner and that beagle dog CYP4A is not highly inducible by PPARα agonists in cultured dog hepatocytes. Furthermore, we have clearly shown that the CYP4A induction response in dog hepatocytes is similar to that observed for human CYP4A11, suggesting a similar mode of regulation. Further work, including in vivo validation of the weak dog CYP4A induction observed in vitro, is required to fully assess the species-specific regulation of the CYP4A induction response.
We gratefully acknowledge the efforts of the GlaxoSmithKline (GSK) sequencing facility and the GSK Laboratory Animal Sciences staff, namely, John Seal, Ermias Woldu, Carmen McLamb, Mary Ann Vasbinder, and Betsy Walton. We thank Bruce Wisely for plasmid DNA construction. We would also like to thank Dr David R. Nelson for his help with the beagle dog CYP4A subfamily assignments and for his insights into evolution of the CYP4A gene family. Thanks to Justin Caravella for bioinformatics assistance. The author (RG) acknowledges that he is employed by GSK, who owns the patent on the compound that appears in the manuscript.
References
Aldridge, T. C., Tugwood, J. D., and Green, S. (
Bell, D. R., Plant, N. J., Rider, C. G., Na, L., Brown, S., Ateitalla, I., Acharya, S. K., Davies, M. H., Elias, E., Jenkins, N. A., et al. (
Blaauboer, B. J., van Holsteijn, C. W., Bleumink, R., Mennes, W. C., van Pelt, F. N., Yap, S. H., van Pelt, J. F., van Iersel, A. A., Timmerman, A., and Schmid, B. P. (
Brown, P. J., Stuart, L. W., Hurley, K. P., Lewis, M. C., Winegar, D. A., Wilson, J. G., Wilkison, W. O., Ittoop, O. R., and Willson, T. M. (
Chang, Y. T., and Loew, G. H. (
Choudhury, A. I., Chahal, S., Bell, A. R., Tomlinson, S. R., Roberts, R. A., Salter, A. M., and Bell, D. R. (
Doggrell, S. A. (
Frick, M. H., Elo, O., Haapa, K., Heinonen, O. P., Heinsalmi, P., Helo, P., Huttunen, J. K., Kaitaniemi, P., Koskinen, P., Manninen, V., et al. (
Graham, R. A., Downey, A., Mudra, D., Krueger, L., Carroll, K., Chengelis, C., Madan, A., and Parkinson, A. (
Graham, R., Tyler, L., Krol, W., Silver, I., Webster, L., Clark, P., Chen, L., Banks, T., and Lecluyse, E. (
Harder, D. R., Campbell, W. B., and Roman, R. J. (
Hardwick, J. P., Song, B. J., Huberman, E., and Gonzalez, F. J. (
Helvig, C., Dishman, E., and Capdevila, J. H. (
Hoch, U., and Ortiz De Montellano, P. R. (
Kawashima, H., Naganuma, T., Kusunose, E., Kono, T., Yasumoto, R., Sugimura, K., and Kishimoto, T. (
Kimura, S., Hanioka, N., Matsunaga, E., and Gonzalez, F. J. (
Kimura, S., Hardwick, J. P., Kozak, C. A., and Gonzalez, F. J. (
Lambe, K., Woodyatt, N., Macdonald, N., Chevalier, S., and Roberts, R. (
LeCluyse, E. L., Bullock, P. L., Parkinson, A., and Hochman, J. H. (
Lee, S. S. T., Pineau, T., Drago, J., Lee, E. J., Owens, J. W., Kroetz, D. L., Fernandez-Salguero, P. M., Westphal, H., and Gonzalez, F. J. (
Lundell, K., Hansson, R., and Wikvall, K. (
Madan, A., DeHaan, R., Mudra, D., Carroll, K., LeCluyse, E., and Parkinson, A. (
Miyachi, H., and Uchiki, H. (
Muerhoff, A. S., Griffin, K. J., and Johnson, E. F. (
Nagasawa, M., Ide, T., Suzuki, M., Tsunoda, M., Akasaka, Y., Okazaki, T., Mochizuki, T., and Murakami, K. (
Nelson, D. R., Koymans, L., Kamataki, T., Stegeman, J. J., Feyereisen, R., Waxman, D. J., Waterman, M. R., Gotoh, O., Coon, M. J., Estabrook, R. W., et al. (
Nguyen, X., Wang, M. H., Reddy, K. M., Falck, J. R., and Schwartzman, M. L. (
Nishimura, M., Yaguti, H., Yoshitsugu, H., Naito, S., and Satoh, T. (
Nithipatikom, K., Endsley, M. P., Moore, J. M., Isbell, M. A., Falck, J. R., Campbell, W. B., and Gross, G. J. (
Nithipatikom, K., Gross, E. R., Endsley, M. P., Moore, J. M., Isbell, M. A., Falck, J. R., Campbell, W. B., and Gross, G. J. (
Okita, R. T., and Okita, J. R. (
Patel, H. R., Hewer, A., Hayes, J. D., Phillips, D. H., and Campbell, F. C. (
Raucy, J. L., Lasker, J., Ozaki, K., and Zoleta, V. (
Richert, L., Lamboley, C., Viollon-Abadie, C., Grass, P., Hartmann, N., Laurent, S., Heyd, B., Mantion, G., Chibout, S. D., and Staedtler, F. (
Sharma, R. K., Doig, M. V., Lewis, D. F., and Gibson, G. G. (
Smith, P. K., Krohn, R. I., Hermanson, G. T., Mallia, A. K., Gartner, F. H., Provenzano, M. D., Fujimoto, E. K., Goeke, N. M., Olson, B. J., and Klenk, D. C. (
Stromstedt, M., Hayashi, S., Zaphiropoulos, P. G., and Gustafsson, J. A. (
Tugwood, J. D., Holden, P. R., James, N. H., Prince, R. A., and Roberts, R. A. (
Uchiki, H., and Miyachi, H. (
Wang, M. H., Stec, D. E., Balazy, M., Mastyugin, V., Yang, C. S., Roman, R. J., and Schwartzman, M. L. (
Wiechelman, K. J., Braun, R. D., and Fitzpatrick, J. D. (
Woodyatt, N., Lambe, K., Myers, K., Tugwood, J., and Roberts, R. (
Author notes
*Division of Molecular Pharmaceutics, School of Pharmacy, The University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599; †MV CEDD DMPK and ‡Discovery Research, GlaxoSmithKline, Research Triangle Park, North Carolina 27709; and §CellzDirect, Inc., Pittsboro, North Carolina 27312
Comments